Similar to what is observed in response to ICAM-1 engagement, activation of eNOS was yet another hallmark of TFFLR, with both Ca2+ and AMPK upstream of its activation

Similar to what is observed in response to ICAM-1 engagement, activation of eNOS was yet another hallmark of TFFLR, with both Ca2+ and AMPK upstream of its activation. BBB ECs, PAR1 stimulation led to activation of signalling pathways essential to TEM; notably involving JNK and endothelial nitric oxide synthase (eNOS), with the latter downstream of AMPK. In turn, nitric oxide production through eNOS was essential for TEM by modulating VE-cadherin on Y731. Collectively, our data showed that non-canonical PAR1 activation by a lymphocyte-released serine protease is required for lymphocyte TEM across the BBB in vitro, and that this feeds into previously established Presatovir (GS-5806) ICAM-1-mediated endothelial TEM signalling pathways. < 0.05, ** < 0.01, *** < 0.001. Assays to measure lymphocyte adhesion to GPNT cells are based on radiolabel assays [7,11], which were altered for use with fluorescent cell labels as previously described [26]. Briefly, fluorescently labelled, concanavalin A (5 g/mL)-activated rat peripheral lymph node (PLN) lymphocytes were added to GPNT monolayers, and after 90 min, adherent T cells were quantified in a fluorescent plate reader. Adhesion data was collected from triplicate experiments each consisting of 10 co-cultures. Control adhesion was 13C17.5% across all experiments. 2.5. RT-PCR Total RNA from GPNTs was prepared using the RNeasy kit (Qiagen, Crawley, UK). 0.25 g of total RNA was reverse transcribed using Superscript III (Invitrogen). PCR reactions were performed using 1 g of cDNA and sequence-specific primers (see also Supplemental Physique S1A): PAR1 (FWD 5 CCT ATG AGA CAG CCA GAA TC 3-REV 5 GCT TCT TGA CCT TCA TCC 3); PAR2 (FWD 5 GCG TGG CTG CTG GGA GGT ATC 3-REV 5 GGA ACA CACNA1G GAA AGA CTC CAA TG 3); PAR3 (FWR 5 GTG TCT CTG CAC ACT TAG TG 3-REV 5 ATA GCA CAA TAC ATG TTG CC 3); PAR4 (FWD 5 GGA ATG CCA GAC GCC CAG CAT C 3-REV 5 GGT GAG GCG TTG ACC ACG CA 3). PCR products were separated by agarose gel electrophoresis, stained with ethidium bromide, and acquired with GeneSys software (Syngene). The molecular weight of the PCR product was compared with the 50 bp DNA ladder (New England BioLabs, Hitchin, UK). Identity of PCR products was verified by additional restriction enzyme digests and DNA sequencing. 2.6. siRNA Knockdown of PAR1 GPNTs were transfected with targeting siRNA as previously described [8]. Briefly, sub-confluent GPNTs were transfected using oligofectamine reagent (Invitrogen, Paisley, UK). Targeting PAR1 siRNA duplexes (200 nM) and non-targeting controls (Dharmacon, Chicago, IL, USA) were transfected in serum-free medium for 4 h, before serum was added back into the medium. After an overnight incubation, the transfection was repeated, and 72 h after the first transfection, the migration assay, as well as the western blotting for PAR-1 protein knockdown (using ATAP-2 antibody), were performed. 2.7. Immunoblotting Cell extracts were prepared by lysis in boiling 50 mM Tris/Cl, pH 6.8, 2% SDS, 10% glycerol, 100 mM DTT. Proteins were separated Presatovir (GS-5806) by SDS-PAGE and transferred to nitrocellulose by semidry electrotransfer. Membranes were blocked o/n and then incubated with the appropriate antibody diluted at 1:2000. Membranes were washed three times with TBS/0.1% Tween-20 before 1h incubation with an anti-mouse or anti-rabbit HRP-conjugated IgG (GE Healthcare) at a dilution of 1 1:10,000 and 1:5000, respectively. Membranes were developed using the ECL reagents (Roche) and exposed to X-ray film. Protein bands were evaluated by densitometric quantification using the NIH imaging software ImageJ and normalized against the amount of total protein and tubulin. 2.8. VE-Cadherin Plasmids Mouse VE-cadherin-EGFP expression plasmids (pEGFP-N1-mVEC) were used for exogenous expression of wild type VE-cadherin in GPNT cells as described26. The Y731 to E substitution was introduced by Quickchange mutagenesis (Stratagene) using the oligonucleotides mVEC-Y731E-up (5 ACGACACACTGCACATCGAGGGATACGAGGGCGCAGAGTCCA 3) and mVEC-Y731E-low (5 TGGACTCTGCGCCCTCGTATCCCTCGATGTGCAGTGTGTCGT 3). All plasmids were verified by DNA sequencing and purified using endotoxin-free preparation methods (Qiagen) before nucleofection (Amaxa) into GPNT cells. 2.9. Data Analysis and Statistics Data are presented as mean SEM. TEM and adhesion data were expressed as percentage of control (TEM: mean SEM of six replicates from at least three impartial experiments; adhesion: mean SEM of six replicates from three impartial experiments). Densitometric quantifications of four impartial immunoblots Presatovir (GS-5806) were determined by changes in phosphoprotein content normalized to tubulin and total protein loading controls, with values expressed as fold increase. Statistics were performed using one-way ANOVA, with significance levels set at 0.05, followed by Dunnetts or Tukeys post-hoc assessments. Alternatively, Student t test was used for pairwise comparison. * < 0.05; ** < 0.01; *** < 0.001. 3. Results 3.1. Endothelial PAR-1 Presatovir (GS-5806) Is Required for Lymphocyte Migration across Rat Brain Microvascular ECs Our experimental system to study lymphocyte migration across brain microvascular ECs consisted of rat GPNT endothelial cell monolayers incubated apically with PAS cells, a TEM qualified MBP-specific rat Th1 cell line [4,9] (Physique 1A). Prior to.